Search Results/Filters    

Filters

Year

Banks




Expert Group











Full-Text


Issue Info: 
  • Year: 

    2019
  • Volume: 

    15
  • Issue: 

    1
  • Pages: 

    25-33
Measures: 
  • Citations: 

    0
  • Views: 

    615
  • Downloads: 

    0
Abstract: 

The history of the Arabian horse goes back about 5 thousand years ago. This breed has played an important role in the life history of human and horse. Regarding to differences existing in the shape and size of the head in horses, using of biometric indices is a practical method to identify a horse breed. The present study was designed to determine the biometric indices of different head regions in the Iranian Arab horse. In this research 9 characteristics of different head regions were evaluated in 30 Iranian Arab horses. These horses were at least 3 years old and were selected from Kerman horse corrals. Then the mean, standard deviation, coefficient of variation, and confidence interval of the characteristics were calculated by use of Stata 10. 1 software. The data were compared between male and female groups, as well as between the age groups older and younger than 8 years old by independent t-test. The results of this study showed that the length of head and length of lateral aspects of the face had the lowest coefficient of variation among the measured characteristics, respectively. But the inter angular mandibular distance and height of ramus had the highest coefficient of variation, respectively. In this research, the characteristics were compared in different age and sex groups. This comparison showed a significant difference in the length of frontal and the caudal width of head regions in two different sex and age groups respectively.

Yearly Impact: مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic Resources

View 615

مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesDownload 0 مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesCitation 0 مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesRefrence 0
Issue Info: 
  • Year: 

    2010
  • Volume: 

    65
  • Issue: 

    2
  • Pages: 

    115-118
Measures: 
  • Citations: 

    0
  • Views: 

    2064
  • Downloads: 

    0
Abstract: 

Peptic ulcer is a very common disorder in horse race and foals. In the present research possible relationship between gastric ulcer and the prevalence of cardiac arrhythmia were studied in two different horse race. In this respect, 13 Caspian miniature horses and 8 Arab horses were studied. Gastric ulcers and cardiac arrhythmias were diagnosed in 13 horses (62%) and 12 (57%) out of 211 horses, respectively. The observed cardiac arrhythmias were sinus tachycardia, sinus bradycardia, sinus arrhythmia, second degree AV block and SA block. There was no significant relationship between gastric ulcer and cardiac arrhythmia in general and between gastric ulcer and each kind of arrhythmia (p>0.005). Serum calcium, potassium, sodium, magnesium and inorganic phosphorous concentrations were measured in the horses. No significant correlation was seen between serum electrolyte and gastric ulcer or cardiac arrhythmia. Despite lack of significant correlation between cardiac arrhythmia and gastric ulcer, more occarence for some kinds of arrhythmia in affected horses with gastric ulcer was very interesting and need to be further investigated in future.

Yearly Impact: مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic Resources

View 2064

مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesDownload 0 مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesCitation 0 مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesRefrence 0
Journal: 

Issue Info: 
  • Year: 

    2001
  • Volume: 

    13
  • Issue: 

    4 (49)
  • Pages: 

    124-126
Measures: 
  • Citations: 

    0
  • Views: 

    977
  • Downloads: 

    0
Abstract: 

A biochemical survey was conducted to provide a reference value for blood serum total protein and its different fractions of caspian miniature horses, and comparing with those of Iranian arab horse. All animals were devided into 4 age related groups. Group 1,0-36 months old, group 2,37-72 months old, group 3, 73-108 months old and group 4, over 109 months old. Comprehensive statistical studies were based on results considering the age, sex and breed. The values of total protein, total globulin and fractions of alfa 2 and beta 2 globulin were higher in caspian horse than in Iranian arab horse, but albumin and albumin/globulin ratio (A/G) were higher in arab horse. Those significant differences were found between the mares of two breeds except for total protein and alfa 2 globulin. In stallions of both breeds, there are differences in the values of alfa 2, beta 2 and the ratio of A/G No sex related differences were observed in amount of total protein and is fractions between males and females of each breed. Age related differences were found as decrease in albumin and increase in gamma globulin with aging of both breeds.

Yearly Impact: مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic Resources

View 977

مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesDownload 0 مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesCitation 0 مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesRefrence 0
Journal: 

Issue Info: 
  • Year: 

    2007
  • Volume: 

    20
  • Issue: 

    2 ( 75 IN ANIMAL AND FISHERIES SCIENCES)
  • Pages: 

    57-67
Measures: 
  • Citations: 

    0
  • Views: 

    1293
  • Downloads: 

    0
Abstract: 

Blood of 95 Arab and 24 Turkman horses were collected. Horses were divided into four sex, age groups: 1-36, 37-72, 73-144 and> 144 months, serum electrolytes (calcium, magnesium, chloride, phosphorus, sodum and potassium) and non electrolytes (glucose, cholesterol, triglyceride, creatinin, uric acid, direct, indirect and total bilirubin and Blood urea nitrogen)(Bun) were measured by Autoanalyser (Eppendorph). Results showed many differences (p<0.05) among groups.

Yearly Impact: مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic Resources

View 1293

مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesDownload 0 مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesCitation 0 مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesRefrence 0
Issue Info: 
  • Year: 

    2009
  • Volume: 

    5
  • Issue: 

    2 (23)
  • Pages: 

    17-21
Measures: 
  • Citations: 

    0
  • Views: 

    3549
  • Downloads: 

    0
Abstract: 

In order to investigatie the possibility and accuracy of horse sex determination using PCRRFLP within ZFX/ZFY Genes, whole blood samples of 20 Arab horses (l0 samples from female and 10 samples from male) were collected from Khozestan province. DNA was extracted using the modified salting-out procedure. Polymerase Chain Reaction (PCR), for amplification of 448 bp in coding region of ZFX/ZFY, was done using the primers, designed based on bovine ZFX/ZFY sequence. PCR products were digested by BSURI (HaeIII) restriction enzyme. PCR-RFLP genotypes consisted of 2 (403 and 45 bp) and 3 (448, 403 and 45 bp) bands for female and male, respectively. Results indicated that sex determination accuracy in animals was 100%. The successful PCR for equine using bovine primers indicated high conservation and homology in ZFX/ZFY sequence between two species horse and cattle. In conclusion, this gene is a reliable candidate gene for horse sex determination that can be used in sex determination of horse embryos sex.

Yearly Impact: مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic Resources

View 3549

مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesDownload 0 مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesCitation 0 مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesRefrence 0
Issue Info: 
  • Year: 

    2020
  • Volume: 

    12
  • Issue: 

    1
  • Pages: 

    125-133
Measures: 
  • Citations: 

    0
  • Views: 

    452
  • Downloads: 

    0
Abstract: 

Introduction: Body size is one of the main features for the classification of horses. Among these features, the length of the body is one of the aspects that considered essential for animal's nutrition and height at withers applies for intra-species separating. Genome Wide Association Studies have demonstrated LCORL gene code a transcription factor that those polymorphisms are associated with skeletal frame size and body length. Recently, BIEC2-808543 SNP located upstream of LCORL was identified as a genetic diagnostic marker associated with withers height and also the length of Cannon bone in Thoroughbred horses. BIEC2-808543 is This SNP effect on TFIID binding site in TATA box. The substitution of C to T allele causes changes affinity of TFIID to TATA box. because of this is the effect on indicating TFIID by a pro-motor nuclear element which is the first step in mRNA transcription and in result effects on other transcription factors of bone-like AP-1, activator protein-1 transcription factor complex, AP-1 is activated as one complex of mRNA and subsequently transcription get higher. On the other words, skeletal bones are expanded by three chondrocytes, osteoblasts and osteoclasts cells. The difference and performances of these cells are regulated by some special factors that are effective on gene expression. Near the LCORL gene in chromosome 3, there is a QTL which is associated with height at withers, composition of legs, length of horse' s rump, head and jaw of the horse. The purpose of this research was studying of genotype and allele frequency of BIEC2-808543 and its relationship with body size in Iranian Arab horse. Materials and methods: A total of 152 (85 males and 67 females) Iranian Arab horses were used in this study. All horses were born between 1990– 2015, and the mean of age was 7. 3 years. All horse's data were registered at WAHO and was get from Yazd Arabic Horseshoe. The time of this research was 1396 and the information was gathered from horse breeding clubs in the city of Ashkezar. The city of Ashkezar is the center of Arabic horse breeding. Measurements included withers height (cm), chest circumference (cm), and leg length. Also, each horse was judged as view of foot, head and neck and score of 0-20 was registered. The referee of this research was experienced experts in the Iranian horses' club located in Yazd. Blood samples were collected from 141 animals and in the molecular genetic laboratory of Islamic Azad University of Ashkezar stored at − 20° C. Genomic DNA was extracted by Gene All kit (Company Gene All, South Korea (according to the manufacturer’ s protocol. We used Thermocycler for PCR and duplication fragments. The volume of the reaction was 25 μ l including 14 μ l master mix, 1 μ l forward, 1 μ l reverse, 9μ l water. Genotyping for BIEC2-808543 was performed using by PCR-RFLP by Alu1 (Company Sina Clone) restriction enzyme. primer designing was applied primer 3 software and the Restriction Mapper software (Online site was used) for PCR was used to distinct the used restriction enzyme. Forward primer sequence has TGGAGTCAGTTGGGTTTAATG and Reverse primer sequence has GACCGGATAGCATAGAGAGAG. Genetic association analysis for withers height, chest circumference, leg length, and judgment scores were performed using SNPassoc package (R software). compare mean between race and show horse was performed using Non-parametric mann-whitneyU. Weir&Cocker ham'sFst was estimated by FSTAT software. Results and discussion: Results of Genotyping of BIEC2-808543 SNP showed that one of the horses with the name of Meraj Mofidian (father name: Zelzeleh) is CT. The others were TT genotype. In this study 99/2% of horses had the TT genotype. Results represent fixation of T allele of BIEC2-808543 SNP on this gene in Iranian Arab horses. There was no significant difference between scores in three aspects, hands, legs, head and neck of show and race horses. Also, Genotype frequency of BIEC2-80543 SNP of show and race horse was similar. Estimated FST between race and show horses was tiny amount (-0. 005) and show no genetic difference of LCORL gene between two groups. Though there was no significant difference of withers height, and leg length and judgment scores between race and show groups. Conclusion: Allele T in BIEC2-808543 polymorphism in Iranian Arab horse stabilization and approves endurance of this breed. Race Iranian Arab horse have bigger Chest circumference because of racing in short distances.

Yearly Impact: مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic Resources

View 452

مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesDownload 0 مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesCitation 0 مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesRefrence 0
Issue Info: 
  • Year: 

    2007
  • Volume: 

    62
  • Issue: 

    1
  • Pages: 

    93-97
Measures: 
  • Citations: 

    0
  • Views: 

    1387
  • Downloads: 

    0
Abstract: 

In order to determine the lipids and lipoproteins profiles in Iranian khouzestanian Arab horses, blood samples were collected from the jugular vein of 77 horses (47 female, 30 male) from different age groups (<6, 7-12, 12-36,37-60,61- 69 and> 96 months). serum cholesterol and triglyceride were measured by enzymatic methods and lipoproteins by precipitation methods. The results were analyzed by LSD and t - test. Regardless of sex and age, the mean values of total cholesterol (TC), total triglyceride (TG), very low density lipoprotein cholesterol (VLDL-c), low density lipoprotein cholesterol (LDL-c), high density lipoprotein cholesterol (HDL-c) were 71.10± 1.25, 26.05±0.64, 10.91±0.67, 22.71±3.74 and 37.61±1.24 mg/dl, respectively Statistical analysis showed that there was no difference between female and male ones. However, age had a significant effect on LDL-c concentration so that its value decreased with increase in age. The present study revealed that the normal concentrations of lipids and lipoproteins in Iranian Khouzestanian Arab horses differt from the other breeds and those Arabian horses which live in the other areas. This difference may be due to the effect of breed nutrition, various physiological and climatic conditions.

Yearly Impact: مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic Resources

View 1387

مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesDownload 0 مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesCitation 0 مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesRefrence 1
Issue Info: 
  • Year: 

    2013
  • Volume: 

    9 (NEW)
  • Issue: 

    4 (39)
  • Pages: 

    811-816
Measures: 
  • Citations: 

    2
  • Views: 

    877
  • Downloads: 

    0
Abstract: 

This study was conducted to identify the fungi isolated from conjunctival sac of clinically normal Persian Arab horse living in Tabriz, Northwestern Iran and to determine the effect of sex and age variations on the frequency of isolates. Forty-three horses (21 females and 22 males), aged 1-15 years, without clinical evidence of external ocular inflammation were selected and divided into three age groups. Samples were taken from both conjunctival sacs of horses and seeded on the sabouraud dextrose agar and malt extract agar. Plates were incubated at 25oC for 10 days. Data were analyzed by Kruskal-Wallis and Mann-Whitney tests using SAS 9.1. Thirtyeight horses out of 43 (88.37 %) were positive for fungi, 22.43 (51.16 %) had positive culture from both eyes. The isolated fungal species were Candida spp (23.15 %), Penicillium spp (16.84 %), Aspergillus sp (15.78 %), Mucor spp (13.48 %), Alternaria spp (8.42 %), Pseudallescheria spp (6.31%), Chladosporium spp (5.26%), Rhodotorula spp (4.21 %), Curvularia spp (3.15%), Fusariumspp (2.10 %) and Trichoderma sp (1.05 %). There was significant effect of horse sex and age on frequency of fungal isolation. The fungal species isolated are comparable with studies performed in other countries, although the frequency of Candida isolation was so higher which may reflect a geographic difference.

Yearly Impact: مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic Resources

View 877

مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesDownload 0 مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesCitation 2 مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesRefrence 7
Issue Info: 
  • Year: 

    2022
  • Volume: 

    4
  • Issue: 

    2
  • Pages: 

    41-49
Measures: 
  • Citations: 

    0
  • Views: 

    195
  • Downloads: 

    12
Abstract: 

Potomac Horse Fever (PHF) is an acute enterocolitis syndrome causing mild colic, fever and diarrhea in all life stages in horses. It is also responsible for abortion in pregnant mares. The agent of PHF was diagnosed as Neorickettsia risticii. PHF was first diagnosed as a livestock disease, by veterinarians in Maryland State of USA in horses living around Potomac River. Since, most of the cases of disease were recorded in July, August and September, then it was regarded as a seasonal disease. Later studies revealed that a trematode vector takes the role as a vector for transmission. Routine cell culture and PCR were used for clinical diagnosis of the PHF. Using indirect fluorescent antibody tests revealed positive cases in most places of Canada and America, which regarded as former contacts with the agent of disease. Neorickettsia risticii could not be seen in monocyte in prepared blood smears from clinical cases of horses and this is contrary to Anaplasma phagocytophilum which very easily seen in granulocytes of blood in infected horses. Neorickettsia risticii has been isolated from released trematodes from fresh water snails. PHF is not a contagious disease and infected horses could be kept near susceptible horses. PHF is not regarded as a zoonosis. It is concluded that related veterinarians to horse industry in Iran should be informed about the possible occurrence of disease.

Yearly Impact: مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic Resources

View 195

مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesDownload 12 مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesCitation 0 مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesRefrence 0
Author(s): 

Gharahveysi Sh.

Issue Info: 
  • Year: 

    2020
  • Volume: 

    15
  • Issue: 

    3
  • Pages: 

    215-222
Measures: 
  • Citations: 

    0
  • Views: 

    573
  • Downloads: 

    0
Abstract: 

Iran is the origin and rise of the Arabian horse. Each year, the breed originality of the new born horses will be confirmed and registered by the World Arabian Horse Organization (WAHO) through the DNA test. The aim of this study was to unbiased estimation of phenotypic and genetic correlations of the conformation traits with the racing performance traits of the Iranian Arab horse through designing the appropriate statistical models. In a randomized sampling, six important traits were recorded, including withers height, body length, hind cannon circumference, fore cannon circumference, thorax girth and chest depth. The best racing time in distance of 1250 meters, the best racing time in distance of 1750 meters, and the best place in distance of 1250 meters were recorded by reviewing the horse racing films. To estimate the genetic correlations, the multi-trait animal model and derivative free-restricted maximum likelihood and DFREML software were used. The highest and the lowest genetic correlations were estimated for the thorax girth with the best place in distance of 1250 meters (-0. 70± 0. 08) and the fore cannon circumference with the best racing time in distance of 1250 meters (0. 06± 0. 00), respectively. Generally, high genetic correlation was estimated for the body conformation and performance traits. Therefore, at the young age, conformation traits can be used for the selection of the reproductive and appropriated horses for the racing and then reduced the generation interval and increased the genetic progress.

Yearly Impact: مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic Resources

View 573

مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesDownload 0 مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesCitation 0 مرکز اطلاعات علمی Scientific Information Database (SID) - Trusted Source for Research and Academic ResourcesRefrence 0
litScript
email sharing button
telegram sharing button
whatsapp sharing button
linkedin sharing button
twitter sharing button
email sharing button
email sharing button
sharethis sharing button